Optimalisatie van transgenexpressie in banaan Musa spp. via 'matrix attachment regions' (MARs)

Patrizia

Tavormina

Blauwe bananen

Genetisch gemodificeerde aardappelen worden in ‘t rond gegooid, Frankenstein-maïs spookt doorheen de velden en nu zou je geliefkoosde vrucht ook nog eens de kleur van een smurf krijgen! Waar gaat het toch naartoe met de wetenschap! Of hebben deze ‘monsterlijke’ organismen een andere kant die we nog niet kennen?

De mogelijkheden van de plantenbiotechnologie

Het begon allemaal rond 1980, niet in het grote Amerika, maar dichter bij huis in ons klein België. Bent je verrast? De professoren Marc Van Montagu en Jef Schell deden een belangrijke ontdekking die de wereld van de plantenbiologie volledig zou veranderen. Ze kwamen op het spoor van een bijzondere bacterie, Agrobacterium tumefaciens, die een stukje van zijn DNA in het DNA van een plant kan schieten. Dankzij deze revolutionaire ontdekking zijn we vandaag de dag in staat de eigenschappen van planten te veranderen en een bacterie doet al het werk voor ons. Openden Prof. Van Montagu en Prof. Schell hiermee de poort naar een nieuw technologisch tijdperk of veeleer de doos van Pandora? Hmm, moeilijke vraag, er zijn altijd twee kanten aan eenzelfde medaille. In ieder geval is er niets mis mee om een aantal genetisch gemodificeerde planten (gg-planten) op een rijtje te zetten die ontwikkeld zijn of nog in ontwikkeling zijn. Op deze manier schetsen we een beeld van de mogelijke planteneigenschappen die reeds gewijzigd zijn en kan ieder voor zichzelf uitmaken of deze vernieuwende technologie baat of schaadt. De herbicidenresistente maïs klinkt waarschijnlijk het bekendst in de oren, zeker wanneer we het bedrijf Monsanto vermelden dat deze gewassen op de markt bracht. Recent haalde een ander gewas de krantenkoppen: de gg-aardappel resistent aan de schimmel Fytoftora. Er is een trend in de biotechnologische sector om economisch belangrijke gewassen te beschermen tegen allerlei stressen die hun opbrengst doen dalen. Deze stressen kunnen veroorzaakt worden door allerlei virussen, bacteriën, schimmels, insecten of hoge temperaturen, lange periodes van droogte en zoute bodems. We zijn echter nog lang niet uitgepraat. Wetenschappers zijn na jarenlang onderzoek erin geslaagd een rijstvariëteit op de markt te brengen die meer vitamine A bevat, beter bekend als ‘golden rice’. Ook kunnen planten worden ingezet als medicijnfabriekjes of voor de productie van vaccins. En wat denkt u van gg-populieren die zware metalen uit vervuilde bodems kunnen halen? Nu we een brede waaier aan gewassen verbeterd hebben en aangepast aan onze behoeften, is het voor de ambitieuze wetenschapper opnieuw tijd om deze ‘verbeterde planten’ op hun beurt te verbeteren.

Geoptimaliseerde optimalisatie

Zoals iedere held een Achillespees heeft, kampen de gg-planten ook met een beperking: de éne gg-plant is de andere niet. Laten we dit illustreren aan de hand van een voorbeeld met gg-bananen, want daar draait mijn onderzoek tenslotte om. Bananenplanten die genetisch gemodificeerd werden om resistenter te worden aan een bedreigende schimmel vertonen allemaal een verschillende resistentiegraad. Plant A is heel sterk resistent is aan de schimmel, terwijl plant B heel zwak resistent is en plant C matig resistent. De onderlinge eigenschappen van gg-planten kunnen dus sterk variëren en men spreekt hier over ‘variatie in transgenexpressie’. Variatie zorgt voor verrassingen en klinkt op zich wel leuk, maar in dit geval is het nadelig. Zulke variatie ondermijnt namelijk de kwaliteit van gg-planten. Het is zelfs mogelijk dat de verbeterde eigenschappen van gg-planten volledig verdwijnen. Er is met andere woorden nood aan een systeem om stabiele gg-bananenplanten te creëeren. In mijn onderzoek test ik een systeem om ervoor te zorgen dat (i) de nieuwe eigenschap van een gg-bananenplant veel sterker tot uiting komt dan voorheen en dat (ii) alle aangemaakte gg-bananenplanten deze eigenschap even sterk tot uiting brengen.

Om stabiele gg-bananenplanten aan te maken, stippelen we eerst een strategie uit en daarvoor laten we de held van de vorige alinea terug in actie schieten. Een eigenschap die maximaal tot uiting komt, kan vergeleken worden met een held die een gevecht wint. Wie met volle zekerheid wilt dat onze held het gevecht wint, kan hem via twee strategieën een handje toesteken. Enerzijds zorgen we voor extra bescherming door gespierde lijfwachten, eentje rechts en eentje links van de held. Anderzijds schakelen we al op voorhand zoveel mogelijk tegenstanders uit. Het klinkt misschien een beetje als vals spelen, in ieder geval is via deze combinatie succes verzekerd! In mijn onderzoek maak ik gebruik van een unieke combinatie van twee benaderingen die elkaar aanvullen: MARs zijn de lijfwachten en ‘gene silencing’ is de vijand die uitgeschakeld wordt. Het eerste begrip zijn de ‘matrix attachment regions’ of kortweg MARs, niet te verwarren met het heerlijke snoepgoed of andere planeten. Dit zijn speciale stukjes DNA die zich niet omzetten in eiwitten en ze omringen het gen dat we sterker tot expressie willen brengen. Je kan een MAR vergelijken met de kabel waaraan de hoorn van een telefoon verbonden is. Wanneer de kabel zich ontwindt, kunnen enzymen beter het gen omzetten in een eiwit, want ze worden niet gehinderd door de vele lussen in de kabel. Dit wil zeggen dat een bepaalde eigenschap veel beter tot uiting kan komen, zeker in combinatie met het onderdrukken van ‘gene silencing’. ‘Gene silencing’ betekent zoveel als ‘genen het zwijgen opleggen’, maar in dit geval gaan wij het zwijgen opleggen aan de factoren die willen verhinderen dat een nieuwe eigenschap in een gg-plant tot uiting komt. Iedereen nog mee?

Deze nieuwe technologie kan van groot praktisch nut zijn voor bananenplanten. Zij zijn voor hun verbetering namelijk sterk gebaat bij biotechnologie. Bovendien komen deze vernieuwingen in de plantenbiotechnologie niets te vroeg. De laatste tijd worden bananenplantages zo vaak belaagd door schimmels dat er straks geen heerlijke dessertbananen meer op ons bord liggen als we niet ingrijpen. Gg-bananenplanten die zeer resistent zijn aan de bedreigende schimmels of die veel bananen kunnen produceren, zijn dus geen overbodige luxe. Toch blijkt het creëren van stabiele gg-bananenplanten niet zo eenvoudig! In het labo kunnen we met onze eigen ogen zien of de gg-bananenplanten effectief verbeterd zijn via onze technologie. De verbeterde gg-planten kleuren namelijk sterker blauw dan de niet verbeterde gg-planten. We hebben ontdekt dat niet elke MAR het gewenste effect geeft in om het even welke plant. Dat brengt ons als wetenschapper op een queeste naar de geschikte MAR voor de bananenplant. Voorlopig dus geen blauwe bananen in het labo, maar in de toekomst... zeker wel!

Bibliografie

_____________________________ Referentielijst ______________________________ 103

Referentielijst

Abranches, R., Shultz, R.W., Thompson, W., Allen, G.C. (2005a). Matrix attachment regions

and regulated transcription increase and stabilize transgen expression. Plant Biotechnol J, 3: 535-

543.

Abranches, R., Marcel, S., Arcalis, E., Altmann, F., Fevereiro, P. en Stoger., E. (2005b).

Review Plants as bioreactors: A comparative study suggests that Medicago truncatula is a

promising production system. J Biotechnol, 120: 121–134.

Allen, G.C., Hall, G.E., Jr., Michalowski, S., Newman, W., Spiker, S., Weissinger, A.K. en

Thompson, W.F. (1996). High-level transgene expression in plant cells: effects of a strong scaffold

attachment region from tobacco. Plant Cell, 8: 899–913.

Allen, G.C., Spiker, S., en Thompson, W.F. (2000). Use of matrix attachment regions (MARs) to

minimize transgene silencing. Plant Mol Biol, 43: 361-376.

Allen, G.C. (2008). The Role of Nuclear Matrix Attachment Regions in Plants. In: Functional

organisation of the plant nucleus. I. Meier (eds.), Springer, Berlin Heidelberg. p 1-29.

Aluru, M., Xu, Y., Guo, R.,Wang, Z., Li, S. en White, W. (2008). Generation of transgenic maize

with enhanced provitamin A content. J Exp Bot, 59: 3551–3562.

Anandalakshmi, R., Pruss, G.J., Ge, X., Marathe, R., Mallory, A.C., Smith, T.H. en Vance,

V.B. (1998). A viral suppressor of gene silencing in plants. Proc Natl Acad Sci USA, 95: 13079–

13084.

Arinaitwe, G., (2008). An improved Agrobacterium-mediated transformation method for banana

and plantain (Musa spp.). Dissertationes de Agricultura. Doctoraatsproefschrift 781. Katholieke

Universiteit Leuven, Belgium. Faculteit Bio-Ingenieurswetenschappen. 156 p.

Ascenzi, R., Ingram, J.L., Massel, M., Thompson, W.F., Spiker, S. en Weissinger, A.K. (2001).

The role of cell differentiation state and HMG-I/Y in the expression of transgenes flanked by matrix

attachment regions. Transgenic Res, 10: 465–470, 2001.

_____________________________ Referentielijst ______________________________ 104

Bertier, L. (2008). Testen van een plaatsspecifiek recombinatiesysteem in transgene

banaanculturen voor de verwijdering van het selectiemerkergen. Katholieke Universiteit Leuven,

Faculteit Bio-ingenieurswetenschappen. Thesis, 109p.

Beyene, G., Buenrostro-Nava, M.T., M.D., Damaj, Gao, S.-J., Molina, J., Mirkov, J.T. (2011).

Unprecedented enhancement of transient gene expression from minimal cassettes using a double

terminator. Plant Cell Rep, 30: 13–25.

Bi, C.-P. en Benham, C.J. (2004). WebSIDD: Server for prediction of the Stress-Induced Duplex

Destabilized sites in superhelical DNA. Bioinformatics, 20: 1477-1479.

Birch, R.G. (1997). Plant transformation: problems and strategies for practical application. Annu.

Rev. Plant Physiol. Plant Mol Biol, 48: 297–326.

Bode, J., Benham, C., Knopp, A. en Mielke, C. (2000). Transcriptional augmentation: modulation

of gene expression by scaffold/matrix-attached regions (S/MAR elements). Crit Rev Eukaryot Gene

Expr. 10(1): 73-90.

Bode, J., Winkelmann, S., Götz, S., Spiker, S., Tsutsui, K., Chengpeng, B., Prashanth A.K. en

Benham, C. (2006). Correlations between scaffold/matrix attachment region (S/MAR) binding

activity and DNA duplex destabilization energy. J Mol Biol, 358: 597-613.

Bock, R. (2007). Plastid biotechnology: prospects for herbicide and insect resistance, metabolic

engineering and molecular farming. Curr Opin Biotech, 18: 100–106.

Brouwer, C., Bruce, W., Maddock, S., Avramova, Z. en Bowen, B. (2002). Suppression of

transgene silencing by matrix attachment regions in maize: a dual role for the maize 5’ ADH1

matrix attachment region. Plant Cell, 14: 2251–2264.

Butaye, K. (2004). Analysis of transgene expression variation in Arabidopsis thaliana.

Dissertationes de Agricultura. Doctoraatsproefschrift 628. Katholieke Universiteit Leuven, Belgium.

Faculteit Bio-Ingenieurswetenschappen. 140 p.

_____________________________ Referentielijst ______________________________ 105

Butaye, K.J.M., Goderis, I.J.W.M., Wouters, P.F.J., Pues, J.M.T.G., Delauré, S.L., Broekaert,

W.F., Depicker, A., Cammue, B.P.A. en De Bolle, M.F.C. (2004). Stable high-level transgene

expression in Arabidopsis thaliana using gene silencing mutants and matrix attachment regions.

Plant J. 39: 440–449.

Butaye, K.M.J., Cammue, B.P.A., Delaure, S.L., De Bolle, M.F.C. (2005). Approaches to

minimize variation of transgene expression in plants. Mol Breeding, 16: 79–81.

Cai, C.Q., Doyon, Y., Ainley, W.M., Miller, J.C., DeKelver, R.C., Moehle, E.A., Rock, J.M.,

Lee, Y.-L., Garrison, R., Schulenberg, L., Blue, R., Worden, A., Baker, L., Faraji, F., Zhang,

L., Holmes, M.C., Rebar, E.J., Collingwood, T.N., Rubin-Wilson, B., Gregory, P.D., Urnov,

F.D., Petolino, J.F. (2009). Targeted transgene integration in plant cells using designed zinc finger

nucleases. Plant Mol Biol (2009) 69: 699–709.

Cervera, M. (2004). Transgenic Plants: Methods and Protocols. Histochemical and Fluorometric

Assays for uidA (GUS) Gene Detection. Methods in Molecular Biology, 286: 203-213.

Cheng, Z., Targolli, J. en Wu, R. (2001). Tobacco matrix attachment region sequence increased

transgene expression levels in rice plants. Mol Breeding, 7: 317–327.

Clarke, J.L., Daniell, H., Nugent, J.M. (2011). Chloroplast biotechnology, genomics and

evolution: current status, challenges and future directions. Plant Mol Biol (2011) 76: 207–209.

Curaba, J. en Chen, X. (2008). Biochemical Activities of Arabidopsis RNA-dependent RNA

Polymerase 6. J Biol Chem, 283(6): 3059–3066.

Czech, B. en Hannon, G.J. (2011). Small RNA sorting: matchmaking for Argonautes. Nat Rev

Genet, 12: 19-31.

De Bolle, M.F.C., Butaye, K.M.J., Coucke, W.J.W., Goderis, I., Wouters, P.F.J., van Boxel,

N., Broekaert, W.F., Cammue, B.P.A. (2003). Analysis of the influence of promoter elements and

a matrix attachment region on the inter-individual variation of transgene expression in populations

of Arabidopsis thaliana. Plant Sci, 165: 169 – 179.

_____________________________ Referentielijst ______________________________ 106

De Bolle, M.F., Butaye, K.M.J., Goderis, I., Wouters, P.F.J, Jacobs, A., Delauré, S.L.,

Depicker A., Cammue, B.P.A (2007). The influence of matrix attachment regions on transgene

expression in Arabidopsis thaliana wild type and gene silencing mutants. Plant Mol Biol, 63: 533–

543.

Desai, P.N., Shrivastava, N., Padh, H. (2010). Production of heterologous proteins in plants:

Strategies for optimal expression. Biotechnology Advances, 28: 427–435.

De Wilde, C., Podevin, N., Windels, P., Depicker, A. (2001). Silencing of antibody genes in

plants with single-copy transgene inserts as a result of gene dosage effects. Mol Genet Genomics,

265: 647–653.

Di Serio, F., Martínez de Alba, A.E., Navarro, B., Gisel, A. en Flores, R. (2010). RNADependent

RNA Polymerase 6 delays accumulation and precludes meristem invasion of a viroid

that replicates in the nucleus. J Virol, 84 (5): 2477–2489.

Dowson, D.M.J., Ashurst, J.L., Mathias, S.F., Watts, J.W., Wilson, T.M., Dixon, R.A. (1993).

Plant viral leaders influence expression of a reporter gene in tobacco. Plant Mol Biol. 23(1): 97-

109.

Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Heled, J., Kearse, M.,

Moir, R., Stones-Havas, S., Sturrock, S., Thierer, T., Wilson, A. (2010). Geneious v5.1,

Beschikbaar op http://www.geneious.com.

Eamens, A., Wang, M.B., Smith, N.A., Waterhouse, P.M. (2008). RNA silencing in plants:

yesterday, today, and tomorrow. Plant Physiol, 147: 456–468.

Dugdale, B., Becker, D.K., Beetham, P.R., Harding, R.M., en Dale, J.L. (2000). Promoters

derived from banana bunchy top virus DNA-1 to -5 direct vascular-associated expression in

transgenic banana (Musa spp.). Plant Cell Reports, 19: 810-814.

Fukushige, S. en Sauer, B. (1992). Genomic targeting with a positive-selection lox integration

vector allows highly reproducible gene expression in mammalian cells. Proc Natl Acad Sci USA,

89: 7905-7909.

_____________________________ Referentielijst ______________________________ 107

Gheysen, G., Villarroel, R. en Van Montau, M. (1991). Illegitimate recombination in plants: a

model for T-DNA integration. Genes Dev, 5: 287-297.

Grant-Downton, R.T., Dickinson, H.G. (2005). Epigenetics and its implications for plant biology.

1. The epigenetic network in plants. Ann Rev Bot, 96: 1143–1164.

Halweg, C., Thompson, W.F., Spiker, S. (2005). The Rb7 matrix attachment region increases the

likelihood and magnitude of transgene expression in tobacco cells: a flow cytometric study. Plant

Cell, 17 : 418 – 429.

Han, K.H., Ma, C.P. en Strauss, S.H. (1997). Matrix attachment regions (MARs) enhance

transformation frequency and transgene expression in poplar. Transgenic Res. 6: 415 – 420.

Harraghy, N., Gaussin, A., Mermod, N. (2008). Sustained transgen expression using MAR

elements. Current Gene Therapy, 8: 353-366.

Henry, H.Q., Goetze, S., Ye, C.J., Liu, G., Stevens, J.B., Bremer, S.W.,Wykes, S.M., Bode, J.

en Krawetz, S.A. (2004). Chromatin loops are selectively anchored using scaffold/matrixattachment

regions. Journal of Cell Science, 117: 999-1008.

Hermann, S.R., Harding, R.M. en Dale, J.L. (2001). The banana actin 1 promoter drives nearconstitutive

transgene expression in vegetative tissues of banana (Musa spp.). Plant Cell Rep, 20:

525–530.

Hill, T. en Lewicki, P. (2007). STATISTICS Methods and Applications. STATISTICA (data

analysis software system), version 7.1. StatSoft, Tulsa, OK. Beschikbaar op: www.statsoft.com.

Hobbs, S.L.A., Warketin, T.D. en DeLong, C.M.O. (1993). Transgene copy number can be

positively or negatively associated with transgene expression. Plant Mol Biol, 21 (1): 17-26.

Hollick, J.B. (2008) Sensing the epigenome. Trends Plant Sci, 13: 398–404.

Holmes-Davis, R. en Comai, L. (2002). The matrix attachment regions (MARs) associated with

the heat shock cognate 80 gene (HSC80) of tomato represent specific regulatory elements. Mol Gen

Gen, 266 : 891 – 898.

_____________________________ Referentielijst ______________________________ 108

Hood, E.E., Helmer, G. L., Fraley, R. T. en Clinton, M. D. (1986). The hypvervirulence of

Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside of T-DNA. J

Bacteriol, 168: 1291-1301.

Hood, E.E., Gelvin, S.B., Melchers, S. en Hoekema, A. (1993). New Agrobacterium helper

plasmids for gene transfer to plants (EHA105). Transgenic Res, 2: 208-218.

Huang, L.F., Liu, Y.K., Lu, C.A., Hsieh, S.L. en Yu, S.M. (2005). Production of human serum

albumin by sugar starvation induced promoter and rice cell culture. Transgenic Res, 14: 569–581.

Huang, X., Huang, X.L., Xiao, W., Zhao, J.T., Dai, X.M., Chen, Y.F., en Li, X.J. (2007).

Highly efficient Agrobacterium-mediated transformation of embryogenic cell suspensions of Musa

acuminata cv. Mas (AA) via a liquid co-cultivation system. Plant Cell Reports, 26: 1755-1762.

James, C. (2009). Global status of commercialized biotech/GM crops. ISAAA Brief 41: Executive

Summary.

Jin, Z., Shu-Jun, L., Si-Song, M., Wei, Y., Yuan-Lei, H., Qiang, W., Zhong-Ping, L (2004).

Effect of Matrix Attachment Regions on resveratrol production in tobacco with transgene of

stilbene synthase from Parthenocissus henryana. Acta Bot Sin, 46 : 948 – 954.

Kawabe, A. en Miyashita, N.T. (2003). Patterns of codon usage bias in three dicto and four

monocot plant species. Genet Syst, 78: 343-352.

Kay, R., Chan, A., Daly, M. en McPherson, J. (1987). Duplication of CaMV 35S Promoter

Sequences Creates a Strong Enhancer for Plant Genes. Science 236: 1299-1302.

Kim, W.S., Kim, J., Krishnan, H.B., Nahm, B.H. (2005). Expression of Escherichia coli

branching enzyme in caryopses of transgenic rice results in amylopectin with an increased degree of

branching. Planta, 220: 689 – 695.

Kole, C., Michler, C. en Abbott, A.G. (2010). Transgenic crop plants: principles and

developement. Springer, Berlin Heidelberg. 315p.

_____________________________ Referentielijst ______________________________ 109

Kumakura, N., Takeda, A., Fujioka, Y., Motose, H., Takano, R. en Watanabe, Y. (2009).

SGS3 and RDR6 interact and colocalize in cytoplasmic SGS3/RDR6-bodies. FEBS Letters, 583:

1261–1266.

Kumar, S., Franco, M., Allen, G.C. (2006a). Gene targeting: development of novel systems for

genome engineering in plants. In: Teixeira da Silva, J.A. (eds.) Floriculture, ornamental and plant

biotechnology: advances and topical issues. Global Science Books, London, p 84 – 98.

Kumar, S., Allen, G.C., en Thompson, W.F. (2006). Gene targeting in plants: fingers on the

move. Trends Plant Sci, 11: 159-161.

Leegood, R.C. (2007). A welcome diversion from photorespiration. Nat Biotech, 25: 539 – 540.

Levin, J.S., Thompson, W.F., Csinos, A.S., Stephenson, M.G., Weissinger, A.K. (2005). Matrix

attachment regions increase the efficiency and stability of RNA-mediated resistance to tomato

spotted wilt virus in transgenic tobacco. Transgenic Res, 14: 193–206.

Li, J., Brunner, A.M., Meilan, R., en Strauss, S.H. (2008). Matrix attachment region elements

have small and variable effects on transgene expression and stability in field-grown Populus. Plant

Biotechnol J, 6: 887–896.

Liu, J.W. en Tabe, L.M. (1998). The influences of two plant nuclear matrix attachment regions

(MARs) on gene expression in transgenic plants. Plant Cell Physiol, 39: 115–123.

Loc, N.H., Thinh, L.T., Yang, M.-S. en Kim, T.-G. (2011). Highly expressed cholera toxin B

subunit in the fruit of a transgenic tomato (Lycopersicon esculentum L.). Biotechnology and

Bioprocess Engineering, 16 (3): 576-580.

Lyznik, L.A., Gordon-Kamm, W.J. en Tao, Y. (2003). Site-specific recombination for genetic

engineering in plants. Plant Cell Rep, 21: 925–932.

Maas, C., Laufs, J., Grant, S., Korfhage, C., Werr, W. (1991). The combination of a novel

stimulatory element in the first exon of the maize Shrunken-1 gene with the following intron 1

enhances reporter gene expression up to 1000-fold. Plant Mol Biol, 16:199–207.

_____________________________ Referentielijst ______________________________ 110

Mallory, A.C., Parks, G., Endres, M.W., Baulcombe, D., Bowman, L.H., Pruss, G.J. en Vance,

V.B. (2002). The ampliconplus system for high-level expression of transgenes in plants. Nat

Biotechnol, 20: 622–625.

Mankin, S.L., Allen, G.C., Phelan, T., Spiker, S. en Thompson, W.F. (2003). Elevation of

transgene expression level by flanking matrix attachment regions (MAR) is promoter dependent: a

study of the interactions of six promoters with the RB7 3’ MAR. Transgenic Res, 12: 3–12.

Matzke, A.J. en Matzke, M.A. (1998). Position effects and epigenetic silencing of plant

transgenes. Curr Opin Plant Biol, 1: 142–148.

Mayerhofer, R., Koncz-Kalman Z., Nawrath C., Bakkeren G., Crameri A., Angelis K.,

Redei G.P., Schell J., Hohn B. en Koncz C. (1991). T-DNA integration: a mode of illegitimate

recombination in plants. The EMBO Journal, 10 (3): 697-704.

Maximova, S., Miller, C., Antunez de Mayolo, G., Pishak, S., Young, A. en Guiltinan, M.J.

(2003). Stable transformation of Theobroma cacao L. and influence of Matrix Attachment Regions

on GFP expression. Plant Cell Rep, 21: 872 – 883.

Michalowski (1999). Characterization of randomly-obtained matrix attachment regions (MARs)

from higher plants. Biochemistry, 38: 12795-12804.

Mitsuhara, I., Ugaki, M., Hirochika, H., Ohshima, M., Murakami, T., Gotoh, Y., Katayose,

Y., Nakamura, S., Honkura, R., Nishimiya, S., Ueno, K., Mochizuki, A., Tanimoto, H.,

Tsugawa, H., Otsuki, Y. en Ohashi, Y. (1996). Efficient promoter cassettes for enhanced

expression of foreign genes in dicotyledonous and monocotyledonous plants. Plant Cell Physiol,

37: 49–59.

Mlynarova, L., Loonen, A., Heldens, J., Jansen, R.C., Keizer P., Stiekema, W.J. en Nap J.P.

(1994). Reduced position effect in mature transgenic plants conferred by the chicken lysozyme

matrix-associated region. Plant Cell, 6: 417 – 426.

Mlynarova, L., Jansen, R.C., Conner, A.J., Stiekema, W.J. en Nap J.P. (1995). The MARmediated

reduction in position effect can be uncoupled from copy number-dependent expression in

transgenic plants. Plant Cell, 7: 599–609.

_____________________________ Referentielijst ______________________________ 111

Mlynarova, L., Loonen, A., Mietkiewska, E., Jansen, R.C. en Nap, J.P. (2002). Assembly of

two transgenes in an artificial chromatin domain gives highly coordinated expression in tobacco.

Genetics, 160: 727 – 740.

Mlynarova, L., Hricova, A., Loonen, A. en Nap J.P. (2003). The presence of a chromatin

boundary appears to shield a transgene in tobacco from RNA silencing. Plant Cell, 15: 2203 –

2217.

Müller, A.E. (2010). Gene Silencing in Plants: transgenes as targets and effectors. In: Kempken, F.

en Jung, C. (eds.). Genetic Modification of Plants, Biotechnology in Agriculture and Forestry 64.

Springer, Berlin Heidelberg. p 79-101.

NanoDrop Technologies Inc (2007). Nanodrop: thechnical support bulletin. NanoDrop

Technologies Inc, Wilmington, Delaware USA. 2p.

Niessen, M., Thiruveedhi, K., Rosenkranz, R., Kebeish, R., Hirsch, H-J., Kreuzaler, F. en

Peterhansel, C. (2007). Mitochondrial glycolate oxidation contributes to photorespiration in higher

plants. J Exp Bot, 58: 2709 – 2715.

Oh, S.J. , Jeong, J.S., Kim, E.H., Yi, N.R., Yi, S.I., Jang, I.C., Kim, Y.S., Suh, S.C., Nahm,

B.H. en Kim J.K. (2005). Matrix attachment region from the chicken lysozyme locus reduces

variability in transgene expression and confers copy number-dependence in transgenic rice plants.

Plant Cell Rep, 24: 145 – 154.

Ollevier, F. en Wenseleers, T. (2000). Werkcolleges statistische gegevensverwerking. Katholieke

Universiteit Leuven, Laboratorium voor Ecologie en Aquacultuur. p 1-39.

Ow, D.W. (2007). GM maize from site-specific recombination technology, what next? Curr Opin

Biotechnol, 18: 115–120.

Padidam, M. (2003). Chemically regulated gene expression in plants. Curr Opin Plant Biol, 6:

169–177.

Peach, C. en Velten, J. (1991). Transgene expression variability (position effect) of CAT and GUS

reporter genes driven by linked divergent T-DNA promotors. Plant Mol Biol, 17: 49-60.

_____________________________ Referentielijst ______________________________ 112

Pelczar, C.P., Kalck, V., Gomez, D. en Hohn, B. (2004). Agrobacterium proteins VirD2 and

VirE2 mediate precise integration of synthetic T-DNA complexes in mammalian cells. EMBO

reports, 5 (6): 632–637.

Peragine, A., Yoshikawa, M., Wu, G., Albrecht, H.L. en Poethig, R.S. (2004). SGS3 and

SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting

siRNAs in Arabidopsis. Genes Dev., 18: 2368–2379.

Peréz-Hernandez, J.B., Remy, S., Swennen, R., en Sági, L. (2006). Banana (Musa spp.). In:

Methods in Molecular Biology, 344: Agrobacterium Protocols, volume 2. K. Wang Editor. Humana

Press Inc. Totowa, NJ, USA. 167-175.

Perlak, F.J., Fuchs, R.L., Dean, D.A.,McPherson, S.L. en Fischhoff, D.A. (1991). Modification

of the coding sequence enhances plant expression of insect control genes. Proc Natl Acad Sci USA,

88: 3324–28.

Petersen, K. , Leah, R. , Knudsen, S., Cameron-Mills, V. (2002). Matrix attachment regions

(MARs) enhance transformation frequencies and reduce variance of transgene expression in barley.

Plant Mol Biol, 49 : 45 – 58.

Pitzschke, A. en Hirt, H. (2010). Agrobacterium-induced tumour formation in plants by plant

transformation. The EMBO Journal, 29 (6): 1021–1032.

Pruss, G.J., Lawrence, C.B., Bass, T., Li, Q.Q., Bowman, L.H. en Vance, V. (2004). The

potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens. Virology,

320: 107–120.

Puchta, H. (2005). The repair of double-strand breaks in plants: mechanisms and consequences for

genome evolution. J Exp Bot, 56: 1-14.

Remy, S., Buyens, A., Cammue, B.P.A., Swennen, R., en Sági, L. (1998). Production of

transgenic banana plants expressing antifungal proteins. Acta Horticulturae, 490: 433-436.

Sági, L., Panis, B., Remy, S., Schoofs, H., Desmet, K., Swennen, R., en Cammue, B.P.A.

(1995a). Genetic transformation of banana and plantain (Musa spp.) via particle bombardment. Nat

Biotechnol, 13: 481-485.

_____________________________ Referentielijst ______________________________ 113

Samadder, P., Sivamani, E., Lu, J., Li, X. en Qu, R. (2008). Transcriptional and posttranscriptional

enhancement of gene expression by the 5′ UTR intron of rice rubi3 gene in

transgenic rice cells. Mol Genet Genomics, 279: 429–39.

Santos, E., Remy, S., Thiry, E., Windelinckx, S., Swennen, R. en Sági, L. (2009).

Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture

and low temperature stress. BMC Plant Biology, 9 (77): 1-15.

Scheid, O.M., Paszkowski, J. en Potrykus, I. (1991). Reversible inactivation of a transgene in

Arabidopsis thaliana. Mol Gen Genet, 228: 104-112.

Schöffl, F., Schroder, G., Kliem, M. en Rieping, M. (1993). An SAR sequence containing 395 bp

DNA fragment mediates enhanced, gene-dosage-correlated expression of a chimaeric heat shock

gene in transgenic tobacco plants. Transgenic Res, 2: 93–100.

Sels, J., Delauré, S.L., Aerts, A.M., Proost, P., Cammue, B.P.A. en De Bolle, M.F.C. (2007).

Use of a PTGS-MAR expression system for efficient in planta production of bioactive Arabidopsis

thaliana plant defensins. Transgenic Res, 16: 531–538.

Sharma, A.K., en Sharma, M.K. (2009). Plants as bioreactors: Recent developments and

emerging opportunities. Biotechnology Advances, 27: 811–832.

Sidorenko, L., Bruce, W., Maddock, S., Tagliani, L., Li, X.G., Daniels, M. en Peterson, T.

(2003). Functional analysis of two matrix attachment region (MAR) elements in transgenic maize

plants. Transgenic Res, 12 : 137 – 154.

Singh, G.B., Kramer, J.A., Krawetz, S.A. (1997). Mathematical model to predict regions of

chromatin attachment to the nuclear matrix . Nucleic Acids Res, 25 : 1419 – 1425.

Smith, N.A., Singh, S.P., Wang, M.B., Stoutjesdijk, P.A., Green, A.G. en Waterhouse, P.M.

(2000). Gene expression – total silencing by intron-spliced hairpin RNAs. Nature, 407: 319–320.

Spiker, S. en Thompson, W.F. (1996). Nuclear matrix attachment regions and transgene

expression in plants. Plant Physiology, 110: 15-21.

_____________________________ Referentielijst ______________________________ 114

Srivastava, V. en Ow, D.G. (2004). Marker-free site-specific gene integration in plants. Trends in

Biotechnology, 22 (12): 627 - 629.

Ülker, B., Allen, G.C., Thompson, W.F., Spiker, S., Weissinger, A.K. (1999). A tobacco matrix

attachment region reduces the loss of transgene expression in the progeny of transgenic tobacco

plants. Plant J, 18 : 253 – 263.

Vain, P., Worland, B., Kohli, A., Snape, W., Christou, P., Allen, G.C. en Thompson, W.F.

(1999). Matrix attachment regions increase transgene expression levels and stability in transgenic

rice plants and their progeny. Plant J, 18: 233–242.

Valkov, V.T., Gargano, D., Manna, C., Formisano, G., Dix, P.J., Gray, J.C., Scotti, N. en

Cardi, T. (2011). High efficiency plastid transformation in potato and regulation of transgene

expression in leaves and tubers by alternative 5’ and 3’ regulatory sequences. Transgenic Res, 20:

137–151.

Vaistij, F.E. en Jones, L. (2009). Compromised virus-induced gene silencing in RDR6-deficient

plants. Plant Physiology, 149: 1399–1407.

van der Geest, A.H.M., Hall, G.E., Spiker, S. en Hall, T.C. (1994). The β-phaseolin gene is

flanked by matrix attachment regions. Plant J, 6: 413 – 423.

van der Geest, A.H.M., Welter, M.E., Woosley, A.T., Pareddy, D.R., Pavelko, S.E., Skokut, M.

en Ainley, W.M. (2004). A short synthetic MAR positively affects transgene expression in rice and

Arabidopsis. Plant Biotechnol J, 2: 13–26.

Van Leeuwen, W., Mlynarova, L., Nap, J.P., van der Plas, L.H. en van der Krol, A.R. (2001).

The effect of MAR elements on variation in spatial and temporal regulation of transgene

expression. Plant Mol Biol, 47: 543 – 554.

Vaucheret, H., Beclin, C., Elmayan, T., Feuerbach, F., Godon, C., Morel, J.B., Mourrain, P.,

Palauqui, J.C., en Vernhettes, S. (1998a). Transgene-induced gene silencing in plants. Plant J, 16:

651-659.

_____________________________ Referentielijst ______________________________ 115

Vaucheret, H., Elmayan, T., Thierry, D., van der Geest, A., Hall, T., Conner, A.J., Mlynarova,

L. en Nap, J-P. (1998b). Flank matrix attachment regions (MARs) from chicken, bean, yeast or

tobacco do not prevent homolgy-dependent trans-silencing in transgenic tobacco plants. Mol Gen

Genet, 259: 388-392.

Vaucheret, H. en Fagard, M. (2001). Transcriptional gene silencing in plants: targets, inducers

and regulators. Trends in Genetics, 17 (1): 29-34.

Vaucheret, H. (2006). Post-transcriptional small RNA pathways in plants: mechanisms and

regulations. Genes & Development, 20: 759-771.

Vishnevetsky, J., White, T.L., Palmateer, A.J., Flaishman, M., Cohen, Y., Elad, Y., Velcheva,

M., Hanania, U., Sahar, N. en Dgani, O. (2010). Improved tolerance toward fungal diseases in

transgenic Cavendish banana (Musa spp. AAA group) cv. Grand Nain. Transgenic Res, 20 (1): 61-

72.

Voinnet, O., Rives, S., Mestre, P. en Baulcombe, D. (2003). An enhanced transient expression

system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt

virus. Plant J, 33: 949–956.

Wagaba, H. (2008). Activity of native constitutive promoters in transgenic banana lines. Vrije

Universiteit Brussel, Katholieke Universiteit Leuven en Universiteit Antwerpen. Thesis, 95p.

Wassenegger, M. en Krczal, G. (2006). Nomenclature and functions of RNA-directed RNA

polymerases. Trends Plant Sci, 11:142–151.

Wright, D.A., Townsend, J.A., Winfrey, Jr. R.J., Irwin, P.A., Rajagopal, J. en Lonosky, P.M.

(2005). Highfrequency homologous recombination in plants mediated by zinc-finger nucleases.

Plant J, 44: 693–705.

Yang, D., Guo, F., Liu, B., Huang, N. en Watkins, S.C. (2003). Expression and localization of

human lysozyme in the endosperm of transgenic rice. Planta, 216: 597–603.

Yunus, G.K.A., Parveez, I. en Ho, C. (2008). Transgenic plants producing

polyhydroxyalkanoates. Asia Pacific J Mol Biol Biotechnol, 16: 1–10.

_____________________________ Referentielijst ______________________________ 116

Xue, H., Yang, Y.-T., Wu, C.-A., Yang, G.-D., Zhang, M.-M. en Zheng, C.-C. (2005). TM2, a

novel strong matrix attachment region isolated from tobacco, increases transgene expression in

transgenic rice calli and plants. Theor Appl Genet, 110: 620–627.

Zeyenko, V., Ryabovaa, L.A., Gallieb, D.R. en Spirin, A.S. (1994). Enhancing effect of the 3’-

untranslated region of tobacco mosaic virus RNA on protein synthesis in vitro. FEBS Letters, 354:

271-273.

Zhang, M.-M., Jia, L.-S., Xuea, H., Yanga, Y.-T., Wua, C.-A. en Zheng, C.-C. (2007). High

transformation frequency of tobacco and rice via Agrobacterium-mediated gene transfer by flanking

a tobacco matrix attachment region. Physiologia Plantarum, 129: 644–651.

_____________________________ Bijlage ______________________________ 117

Bijlage I

Sequentie van het 3’-uiteinde van het cDNA van het rdr6 uit O. sativa:

AAAAGATTCTTGGAAGGCTTTATCGTTCAATCCAAGAGGCCTCCAATGGTGATGTGG

TGTCACAAGAGGTTTGCACTCCAAATGATCTGCCTTATGACATAGATCTGGAAGTTC

CTGGTGCATCAGATTTCCTCGCGAGTGCTTGGCAATGCAAGTGTTCATACGACGCGC

AGCTGAGTGCGCTGCTCAGTCAGTACAGGGTCCGCACTGAAGCTGAACTTGTGACAG

GGCACATAACGTTCCTTGTTAAGAACAGCAGCAAGAAGCAAGGCGACATAAAGGACA

GGCTGAAGACTGCTTACTCTGCACTACGCAAGGAGTTCAAAAGTACCTTTGAGAGCA

TAGCATCGGATCAATGCGAGATTGGTGATGACGAGAAGAATCTGCTGTACGAGATGA

AGGCCTCTGCCTGGTACCAGGTGACCTATCACCCCAAATGGGTGGAGAAGTCGAGGG

GCATTCTGGGCCCAGATGGTGAGGAAATACCGGCAAGCCTTAGCTTTGCATGGATCC

CGGTGGATTACTTGGCGCGGATAAAGCTAAGGTGCCATGGTAAAGTGAGAGTTGAAG

GCCAAAAGCCTGTTGAAAGGCTTG

Primersequenties (zonder knipplaatsen voor restrictie-enzymen) van het kort en lang fragment zijn

onderlijnd. Het lang fragment is grijs gemarkeerd. Het kort fragment is vet gedrukt.

1) Ligging van het lang fragment (grijs) en het kort fragment (zwart) in het ‘hairpin’-construct.

2) Vorming van een rdr6-‘hairpin’ na transcriptie, omwille van de aanwezigheid van

complementaire delen in het korte en lange fragment.